In this second task, you are asked to count DNA nucleotides in a given sequence. A DNA sequence can be understood as a string, an ordered collection of symbols from the DNA alphabet: ‘A’, ‘C’, ‘G’ and ‘T’. Each of these symbols represents a DNA nucleotide: adenine (‘A’), cytosine (‘C’), guanine (‘G’), and thymine (‘T’).

Given a string representing a DNA sequence, you have to write a function that counts how many nucleotides of each type compose the sequence; that is, how many symbols ‘A’, ‘C’, ‘G’ and ‘T’ there are (and in this order!). For example:

seq1 = ‘ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTGTAGATCTGTTCTCTAAACGA’

count_nucleotides(seq1) → Output: [21, 18, 10, 21]

The input here is the DNA sequence stored as a string in variable seq1. The output is a list indicating that there are 21 ‘A’, 18 ‘C’, 10 ‘G’ and 21 ‘T’ in the sequence.

To check if your code solves correctly the problem, follow these steps in the interactive console:

1. Copy your code above for the definition of count_nucleotides(DNA_seq) function in the console (you may need to do this line by line). Important: Copy the whole function definition: def count_nucleotides(DNA_seq): …
2. Call check.check(count_nucleotides) in the console and press ENTER.
3. If your code gives the correct answer, you will retrieve the password to get to the next exercise!